Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Lemur catta (Ring-tailed lemur) lca-miR-18 URS00000A05D9_9447

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAGGUGCAUCUAGUGCAGAUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 34 other species

  1. Ateles geoffroyi age-miR-18
  2. Bos taurus bta-miR-18a
  3. Canis lupus familiaris cfa-miR-18a
  4. Columba livia cli-miR-18a-5p
  5. Danio rerio (zebrafish) dre-miR-18a
  6. Gadus morhua gmo-miR-18a-5p
  7. Gallus gallus gga-miR-18a-5p
  8. Gorilla gorilla gorilla ggo-miR-18a (MIR18A)
  9. Gorilla gorilla ggo-miR-18a
  10. Haplochromis burtoni abu-miR-18a
  11. Homo sapiens (human) miscellaneous RNA
  12. Lagothrix lagotricha lla-miR-18
  13. Macaca mulatta (Rhesus monkey) mml-miR-18a-5p
  14. Macaca nemestrina (pig-tailed macaque) mne-miR-18
  15. Maylandia zebra (zebra mbuna) mze-miR-18a
  16. Monodelphis domestica mdo-miR-18a-5p
  17. Mus musculus Mus_musculus piRNA piR-mmu-72635
  18. Neolamprologus brichardi (lyretail cichlid) nbr-miR-18a
  19. Oreochromis niloticus oni-miR-18a
  20. Pan paniscus (pygmy chimpanzee) ppa-miR-18
  21. Pan troglodytes ptr-miR-18a
  22. Pongo pygmaeus (Bornean orangutan) ppy-miR-18a
  23. Pteropus alecto pal-miR-18a-5p
  24. Pundamilia nyererei pny-miR-18a
  25. Rattus norvegicus Rattus_norvegicus piRNA piR-rno-63164
  26. Saguinus labiatus (red-chested mustached tamarin) sla-miR-18
  27. Salmo salar ssa-miR-18b-5p
  28. Sus scrofa (pig) ssc-miR-18a
  29. Taeniopygia guttata (zebra finch) tgu-miR-18a
  30. Takifugu rubripes fru-miR-18
  31. Tetraodon nigroviridis tni-miR-18
  32. Tor tambroides miR-18a
  33. Xenopus laevis (African clawed frog) xla-miR-18a
  34. Xenopus tropicalis Xenopus_tropicalis piRNA piR-xtr-3307188