Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Chrysemys picta (Painted turtle) cpi-miR-221-3p URS000009C94C_8479

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGCUACAUUGUCUGCUGGGUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 19 other species

  1. Anolis carolinensis aca-miR-221-3p
  2. Bos taurus (cattle) bta-miR-221
  3. Canis lupus familiaris cfa-miR-221
  4. Capra hircus (goat) chi-miR-221-3p
  5. Columba livia cli-miR-221-3p
  6. Gadus morhua (Atlantic cod) gmo-miR-221-3p
  7. Ictalurus punctatus (channel catfish) ipu-miR-221
  8. Microcaecilia unicolor Mun-Mir-221-P2a_3p (mature (guide))
  9. Mus musculus Mus_musculus piRNA piR-mmu-72620
  10. Ornithorhynchus anatinus oan-miR-221-3p
  11. Ovis aries (sheep) oar-miR-221
  12. Paralichthys olivaceus pol-miR-221-3p
  13. Pteropus alecto (black flying fox) pal-miR-221-3p
  14. Python bivittatus pbv-miR-221-3p
  15. Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62979
  16. Salmo salar ssa-miR-221-5p
  17. Sus scrofa (pig) ssc-miR-221-3p
  18. Xenopus laevis (African clawed frog) xla-miR-221-3p
  19. Xenopus tropicalis (tropical clawed frog) Xenopus_tropicalis piRNA piR-xtr-3647375