v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Pan troglodytes verus tRNA-Met secondary structure diagram

Pan troglodytes verus tRNA-Met URS000006E464_37012

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUAAGGUCAGCUAAAUAAGCUAUCGGGCCCAUACCCCGAAAAUGUUGGUUAUACCCUUCCCGUACUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 29 other species

  1. Cloning vector pRS316-1B9 tRNA-Met
  2. Colobus guereza tRNA-Met
  3. Homo sapiens mitochondrially encoded tRNA-Met (AUA/G) (MT-TM)
  4. Homo sapiens neanderthalensis neanderthalensis transfer RNA-Met
  5. Hylobates lar (common gibbon) transfer RNA-Met
  6. Hylobates muelleri tRNA-Met
  7. Pan paniscus mitochondrially encoded tRNA-Met (AUA/G) (ENSPPAG00000000009.1)
  8. Pan troglodytes tRNA-Met
  9. Pan troglodytes ellioti tRNA-Met
  10. Pan troglodytes schweinfurthii tRNA-Met
  11. Pan troglodytes troglodytes tRNA-Met
  12. Pan troglodytes ellioti tRNA-Met
  13. Piliocolobus badius (western red colobus) tRNA-Met
  14. Plecotus auritus tRNA-Met
  15. Plecotus macrobullaris tRNA-Met
  16. Pongo abelii (Sumatran orangutan) tRNA (ENSPPYG00000020948.1)
  17. Presbytis sp. Pres2 tRNA-Met
  18. Pygathrix nemaeus (Red shanked douc langur) tRNA-Met
  19. Rhinopithecus bieti 1 RL-2012 tRNA-Met
  20. Rhinopithecus bieti 2 RL-2012 tRNA-Met
  21. Rhinopithecus bieti mitochondrially encoded tRNA-Met (AUA/G) (ENSRBIG00000000009.1)
  22. Trachypithecus barbei tRNA-Met
  23. Trachypithecus germaini (Indochinese lutung) tRNA-Met
  24. Trachypithecus hatinhensis tRNA-Met
  25. Trachypithecus laotum (Laotian langur) tRNA-Met
  26. Trachypithecus obscurus tRNA-Met
  27. Trachypithecus phayrei tRNA-Met
  28. Trachypithecus pileatus tRNA-Met
  29. Trachypithecus shortridgei (Shortridge's langur) tRNA-Met
 2D structure