tRNA (75-MER)of Spodoptera frugiperda from Spodoptera frugiperda (PDB 8H8E, chain G)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

tRNA (75-MER)of Spodoptera frugiperda from Spodoptera frugiperda (PDB 8H8E, chain G) URS000291571A_7108

75 nucleotides
1 database (PDBe)
Found in 1 other species

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UCUUCGGUAGUAUAGUGGUCAGUAUCCCCGCCUGUCACGCGGGAGACCGGGGUUCGAUUCCCCGCCGGAGAGCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Homo sapiens RNA (75-MER) from Homo sapiens (PDB 9M7U, chain G)

Relationships

Molecular Relationships

2D structure

Loading 2D structure...