v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Parcubacteria group bacterium GW2011_GWA2_47_8 Cobalamin riboswitch secondary structure diagram

Parcubacteria group bacterium GW2011_GWA2_47_8 Cobalamin riboswitch URS0002333162_1618847

  • 153 nucleotides
  • 1 database (Rfam)
  • Found in 2 other species
  • ncRNA

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAAAUCGGAAUCGCCCACCGUACAUUCGCAACUGAACAUUUUUCAUGGGGAAUGAGGUGUGAUGCCUCAACUGUCCCGCAACUGUGAUACGUGUCGCCUGCCGCCUAGAGGCGCCGCGUUAAGUCAGAUCGCCAUGGUGUUCACUCAUAACAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Candidatus Parcubacteria bacterium Parcubacteria bacterium AdoCbl sequence
  2. Parcubacteria group AdoCbl sequence
  3. Parcubacteria group bacterium RIFCSPHIGHO2_01_FULL_47_10b Cobalamin riboswitch
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...