Template RNA from Severe acute respiratory syndrome coronavirus 2 (PDB 6XEZ, chain T)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Template RNA from Severe acute respiratory syndrome coronavirus 2 (PDB 6XEZ, chain T) URS00021ED933_2697049

55 nucleotides
1 database (PDBe)
Found in 1 other species
95 publications
transcript

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CUAUCCCCAUGUGAUUUUAAUAGCUUCUUAGGAGAAUGACGUAGCAUGCUACGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

synthetic construct Template RNA from synthetic construct (PDB 7RE3, chain U)

Relationships

Molecular Relationships

2D structure

Loading 2D structure...

Publications