v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

RNA (5'-R(*UP*AP*UP*AP*CP*CP*UP*CP*UP*GP*CP*UP*UP*CP*UP*GP*CP*UP*AP*UP*U)-3') from synthetic construct (PDB 6QCV, chain R) URS0000EEAD16_32630

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UAUACCUCUGCUUCUGCUAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Influenza B virus 3 end from Influenza B virus (PDB 6QCT, chain R)
  2. Influenza A virus 3' end of the vRNA promoter from Influenza A virus (PDB 9F37, chain R)
  3. Influenza A virus (A/little yellow-shouldered bat/Guatemala/060/2010(H17N10)) 3' vRNA from Influenza A virus (A/little yellow-shouldered bat/Guatemala/060/2010(H17N10)) (PDB 6T0V, chain R)
 Relationships

Molecular Relationships

 Publications