v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Lentisphaerae bacterium RIFOXYB12_FULL_65_16 nhaA-I RNA secondary structure diagram

Lentisphaerae bacterium RIFOXYB12_FULL_65_16 nhaA-I RNA URS0000E604DC_1798581

  • 56 nucleotides
  • 1 database (Rfam)
  • Found in 1 other species
  • ncRNA

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGUGUAACGGCACGGGGGUUCGUUACAGGCGCUCUGGGUGGUCGGGCCGCCAUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. Lentisphaerota bacterium Lentisphaerae bacterium Li+-I sequence
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...