Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Lactobacillus gasseri 224-1 Na+ riboswitch aptamer (DUF1646) secondary structure diagram

Lactobacillus gasseri 224-1 Na+ riboswitch aptamer (DUF1646) URS0000D6AA30_679196

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGUUGGGUUUUAUUUAAAACUUUCAAGAUUUGCUUAUUUGGGUCAAUAAGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Lactobacillus paragasseri JV-V03 Na+ riboswitch aptamer (DUF1646)
  2. Lactobacillus gasseri Na+-I sequence
  3. unclassified sequences Na+-I sequence
Relationships

Molecular Relationships

2D structure

Loading 2D structure...