RNA (5'-R(*AP*CP*UP*AP*CP*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP*AP*C)-3') from unidentified (PDB 6BU9, chain C)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

RNA (5'-R(APCPUPAPCPUPAPUPAPCPAPAPCPCPUPAP*C)-3') from unidentified (PDB 6BU9, chain C) URS0000CBFF4E_32644

52 nucleotides
1 database (PDBe)
Found in 1 other species
3 publications
transcript

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GGCAUGAAUUGGUCUAGGGUCUGGUCUUACUACUAUACAACCUACUACCUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

synthetic construct RNA (31-MER) from synthetic construct (PDB 7TJ2, chain H)

Relationships

Molecular Relationships

Publications

RNA (5'-R(*AP*CP*UP*AP*CP*UP*AP*UP*AP*CP*AP*AP*CP*CP*UP*AP*C)-3') from unidentified (PDB 6BU9, chain C) URS0000CBFF4E_32644