v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Caulobacter crescentus CB15 ZMP/ZTP riboswitch aptamer (pfl RNA motif) secondary structure diagram

Caulobacter crescentus CB15 ZMP/ZTP riboswitch aptamer (pfl RNA motif) URS0000C70190_190650

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CCGCGUUCGCGUGACUGGCGCUAGUGAUGGGGAACCAUCGGGGAGCGUGGACAUCAUAAGCCGCGCGCCUGGGCUCCCUUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Caulobacter vibrioides NA1000 Caulobacter crescentus NA1000 ZMP/ZTP riboswitch aptamer (pfl RNA motif)
  2. Caulobacter vibrioides Caulobacter crescentus ZTP sequence
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications