v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Novosphingobium sp. P6W Glycine riboswitch secondary structure diagram

Novosphingobium sp. P6W Glycine riboswitch URS0000C3BB84_1609758

  • 122 nucleotides
  • 1 database (Rfam)
  • Found in 2 other species
  • ncRNA

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CAGCGAUACUCUGGAAAGUGCCCCGUGCCUUUAAGGUCGUGGCCGCCGACGGUGUAACCCGGCCUGUCCCAUAAGGGAUGACGCCGGGGAAGCUCUCAGGUUUCCGUGACAGAGGGGGCACC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Novosphingobium sp. Glycine sequence
  2. Novosphingobium barchaimii LL02 Novosphingobium sp. LL02 Glycine riboswitch aptamer
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...