v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Sphingomonas sp. BH3 Fluoride riboswitch aptamer (crcB RNA motif) secondary structure diagram

Sphingomonas sp. BH3 Fluoride riboswitch aptamer (crcB RNA motif) URS0000BFEC88_634430

  • 77 nucleotides
  • 1 database (RFAM)
  • Found in 8 other species
  • ncRNA

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCGGGCACGGCGAUGGAUUUCCGCCGGGCCAUUCGGCCGAACCGCCCUCGCAAGGGCCGAUGAUUCCUACCAGGCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Sphingomonas aurantiaca crcB
  2. Sphingomonas sp. Ant20 Fluoride riboswitch aptamer (crcB RNA motif)
  3. Sphingomonas sp. CFBP 8760 Fluoride riboswitch aptamer (crcB RNA motif)
  4. Sphingomonas sp. EC-SD391 crcB
  5. Sphingomonas sp. Fluoride sequence
  6. Sphingomonas sp. Leaf20 Fluoride riboswitch aptamer (crcB RNA motif)
  7. Sphingomonas sp. Leaf412 Fluoride riboswitch aptamer (crcB RNA motif)
  8. Stakelama pacifica Sphingosinicella sp. JLT832 Fluoride riboswitch aptamer (crcB RNA motif)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...