Vibrio shilonii AK1 Fluoride riboswitch aptamer (crcB RNA motif)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Vibrio shilonii AK1 Fluoride riboswitch aptamer (crcB RNA motif) URS0000BECCD2_391591

65 nucleotides
2 databases (RFAM, ZWD)
Found in 1 other species
1. mRNA region
2. riboswitch

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGCAACCAAGGUGAUGGGGUUCCACCUACUUAACCGCCAAAUCGGCUGAUGACUCCUACAGUUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Vibrio mediterranei Vibrio shilonii Fluoride sequence

Relationships

Molecular Relationships

2D structure

Loading 2D structure...