v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) family with sequence similarity 85 member B (FAM85B) URS0000BC465B_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

FAM85B: FAM85B is a functional candidate associated with expression in various tissues, including the lung, heart, skeletal muscle, and coronary and tibial artery [PMC8579601]. It has been previously linked to heart rate response to exercise and recovery in genome-wide association studies (GWASs) [PMC8579601]. FAM85B is located in the exon and provides a polyadenylation signal for transcript termination [PMC7201656]. In addition to FAM85B, eQTL analyses identified three other possible non-coding genes (RP11-481A20.10 and RP11-481A20.11) that may be involved in mood instability through RNA interference or post-transcriptional regulation [PMC7116257]. The competing pseudo gene FAM86B3P shows lower evidence for colocalization with FAM85B [PMC7550587]. THOC7 is another potential candidate gene that colocalizes with FAM85B [PMC7550587]. Furthermore, several genes including FAM85B and its pseudo gene FAM86B3P show a negative direction of Wald ratio effect, suggesting a relationship between decreased gene expression and increased schizophrenia risk [PMC7819609]. It is worth noting that eQTLs for both FAM86B3P and FAM85B are in high linkage disequilibrium (LD), which limits the resolution of Mendelian randomization analyses [PMC7819609]. Overall, these findings highlight the potential functional role of FAM85B in various biological processes [PMC8579601].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGGUUCGCGCUUUGGUCCUGGAGGCCUUAUCCUAGCCUCCUCUGUAUCAGCGCCACCAGUCUGGGGCCCGAAAGGAGGGAGCUUUCCCUCUGUCCCCCAGCCUUUGGACUGUCACCAAACAAGCCAUUCGUUCACCAAAUACUUAUUAAGCGCCUACCAUGUGCCUGACAAGGGAGAUGUAACGAUAGAGUCUCUCUCUCUGCCACCCAGGCCAGAGUGCAGUUGACGCAGGGCAGGGGAGCCCCGAAGUGGAGCAUAGUGUGUCCGGAACUGGUGGGUUCUUGGUCUCCCUGACUUCAAGAAUGAAGCCACGGACCCUCGGGAAACUCCUGGAGGGCAGAGGCAUGCCUGCCAUCUUCAUCAUUGCAUUACCACCACCCAACACUAUCGGGGGACCUGCCCUGAUAAUCAGUCUACAGGUGUAUCCAGCAGCUCCAGAGAGACAGCGACCAGCGAGAAGGGGCCAUGAUGAUGGUGGUGGUUUUGUCAAAACGAAAAGGGGGAUAUGUAGGGAAAAGAAAGAGAGAUCAGACUGUUACUGUGUCUACAUAGAAAGGGAAGCCAUAAGAGACUCCAUUUUGAAAAAGACCUGUACUUUAAACAAUUGCUUGCUGAGAUGUUGUUUAUCUGUAGCUUUGCCCCAGCCACUUUGCCCCAACCACUUUGACCCAAUCUGGAGCUCACAAAAACAUGUUUGUAUGAAAUCAAGGUUUAAGGCAUGUAGGGCUGUGCAGGACGUGCCUUGUUAACCAAAUAUUUGGAAGCAGUAUACUUGGUAAAAGUCAUCACCAUUCUCUCGUCUCAAUAAACCAGGGGCACAAUGCACUGUGGAAAGCCGCAGGGACCUCUGCCCUUGAAAGCUGGGUAUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications