v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 2446 (LINC02446) URS0000BC462C_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC02446: LINC02446 is a long non-coding RNA (lncRNA) that has been implicated in various biological processes and diseases. It has been shown to be negatively associated with hsa.miR.891a.5p, LINC01857, and IL7R, suggesting that hsa.miR.891a.5p may inhibit IL7R expression while LINC02446 and LINC01857 may enhance IL7R abundance [PMC8290234]. In bladder cancer, LINC02446 has been found to inhibit cell proliferation and metastasis [PMC8424867]. In the context of COVID-19, LINC02446 is enriched in the COVID-19/non-ICU group [PMC8057768]. In cervical cancer patients, the expression of LINC02446 is associated with overall survival [PMC8799008]. Furthermore, in bladder cancer (BLCA), high expression of LINC02446 is a favorable prognostic factor [PMC7786330]. Univariate Cox analysis identified LINC02446 as a favorable prognostic factor for patients [PMC9334800]. Overall, these findings suggest that LINC02446 may play a role in inhibiting tumor proliferation and metastasis while also serving as a favorable prognostic factor in certain cancers.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GCUUGGCCCACUCUCACUCUGUGGAGUGUACAUUUGUUUCCAUAAAUCUGUGCUUUUUUUUUCAUUGUUUUGUUUGUGCAUUUCAUCCAAUUGUUUGUUCAAAAUGCCAAGAAUCUGGACACCCUCCACCAGUAACAGGCAUUGGGAAGGGGAAGGCAGAAAAGCGGAGUGCAAAAUGAAGUGGUAGUGGGUGCUAACUAACAAGAGAACCUUUGAACACGAUGGGACAGAAAUAAGGUCAUGCAUUUUCUACUAUCUGUCACCUGUGGACAACUUGCCACUUCAACAGUUCUGGACACUUUUAAGCUCCCCCGAGGAGAAGAUAGGAAACUUGGACACCCUGUGUGGGAUUGAGAAUCACAAAGGGGCAGUCUCGCACCUGGUCAAGAUAAAGCUGAACUGAACUCUUCAUUCACAAGUGGGAUUCUCGUAAGAGGCAGGAAAGCAGGGACCGUCUGUCACUACAGACAGCAAGAAGAGGUGAACCUUAAUGAGGGAAGAAAACAGAUUCUAUUAGGGGAAAAAAACAUUUAAUCAGAAAAUAAGGCUCUGGAAAGAAAAGGCCAAUUGGGGCUUUGUCUGAAGAAAUAACAGAGUAUUUUUCUGCCAGAGAAAGCAAGUCCAAGGGAGGAAUUUUCAGAUUGACCAAAGAGUAUUGGUCUACAUCAUUAGUACUUUCAGUGAGAAAUAACUGAAAAUAAACUAGAGCAAAAGUUCCCCAGGUGUGGUUCCAGGACCAGCAACUGAAACAUCACCUGGGAACUGUUAAAAAUGCAAAUUCUUGGGCUCUCCGCCAGAAUCACUGAAUCAGAAACUCUGAAAUGGGACCCAAUAAUCAGCAGCUUAACAAGCUCUCCAGGUGAUUCUUAUGCCAAAUAAAGUUUGAAAUUCCCUGGUGCUGGCGCUGGAAGCAAAUGAGUCACAGCUGUGAAGAAUCCCUACCAUUAAUACCCUGGGUGGGAUAAAUAAAAAUGGGAAACUAAAAAGUUAAAUGAUCAGAGGUUGGCUGUAGUUCAAAAGUAAGGAUAUACCUGAAUAUAAAAUUCUUUCUUAACCUAAAUGCAAAAUGGGAAUAUGUUUAAUCAUUUAUAUAGCAUCUCACUGGUUUUUUCCAGCUUGAGACAUGAUUCACAAAAAUUGUAUAUAUUUAAAAUGUACAUGAUGUUUUGAUAUACAUAUACAUUGUGAAACAAUUACCACAAUGAAGUUAACAUAACCAUGACCUCACCUAGCCACCAUUUUGUGUGUGUGGGGUUAAAAACCCUUAAGACCUGCUCUUAGCAAAUGUCAAGUAUACAGUACCUUAUUAUUAACUAUAGUCACCAUGCUGUACGUUAGGUCUCCAGAACUUACUCAUCUUCUAACUAAAAGUUUGACUAACUUCUCCCCCAGCCCCCAACCCCUGGUAACUACCACUCUACCCUUUGUUACUGUGUCUUCAACUUUUUUAGAUUCCACAUACAAGUGAGAUCACGCAAUAUUUGUGUUUUGGCGUCUGGCUUAUUUCACUUAGAAUAGUGUCCUCUAAGUUUAUCCAUGUUGUCACAAAUAGCAGGAUUUCCUUAUAUAUUUAUAGAAUAAAAACUAGACCGAAUUA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications