Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1820 (LINC01820) URS0000BC44DE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01820: LINC01820 is an m6A-lncRNA that has been found to be closely correlated with poor prognosis in patients with kidney renal clear cell carcinoma (KIRC) [PMC8290079]. It has been identified as an independent factor associated with prognosis in KIRC [PMC8290079]. Although LINC01820 and LINC02257 do not regulate tumor behavior through the lncRNA-miRNA-mRNA pathway, they are connected to RNA-binding proteins [PMC8290079]. While there is no survival discrepancy between low and high expression of LINC01820, the m6AlRsPI model based on LINC02257 and LINC01820 shows that the high m6AlRsPI group has a poor prognosis [PMC8290079]. Currently, there are no articles reporting a correlation between LINC01820 and prognosis in other tumors [PMC8290079]. In KIRC cell lines, the expression level of LINC01820 is elevated compared to normal kidney cell lines [PMC8290079]. Although there is no survival discrepancy based on expression level of LINC01820, it is believed to be a prognosis-associated m6A-lncRNA based on the analysis results [PMC8290079]. The prognostic values of LINC01820 and m6AlRsPI have not been validated by external cohorts yet [PMC8290079]. The lncRNAs AC104964.1, SLC7A11-AS1, LINC00616, LINC01820, and AC110011.1 are located near protein-coding genes MSRA, SLC7A11, EPAS1, and DUSP1 in KIRC [PMC7516207]. Weighted co-expression network analysis has been used to select lncRNAs such as LINC02257 and LINC01820 for constructing a KIRC model and analyzing their potential prognostic value [PMC10031908].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UGUAGAAAUAAAAAGUGCAGAUUUAUGAGAGGGGAUGGGUCUACCUGGAGUGACUUGAGGAAUACCCAGAAGACCCCGUCCACCUCCUCCUGCUUAGAAUAUGCCUUUUGCUAGCCUGCUGUGAUGCCUGGAAUUUCAUCCUUCACCCAUUGCUGGGCCCACCCACAUAGUUUAAAGCCAAGAUCAGGACAGAGAUGGAGGGAGCUGUCCCCUGGCCACCCUGAUACCUGCUGUUGGAAAUCAACAAACAAACACAAACCCACUUUGCGUUCUGUGAGUGUGCAUGUAUGUUGGUCCCUAGGUGCUGCAGGACAAGAGGAGGGCCAGAAAGCUCUGCCCAUGCCUGGGGAGCAUGCUGGAUCUCCCUUCCAGCUACAGAAGAGGUCUAUGGUUUCUUAGACACGCGUGGAUUCUCACAGCCACCACCACAGACAGUACAAGCAACAGUUCCAAUACUCCAGAGAACGCCCUCAUCUCUCCUCACCCCUGCCUUCUGGCAAGCAAUGAGCUGUUCUCUGUUCCUGUAUUUUUGCCUUUUCUAGAAUGCCAUAUAAAUGGAAUUAUAUAGAAUGUG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications