Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) MNX1 antisense RNA 2 (MNX1-AS2) URS0000BC44DB_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MNX1-AS2: MNX1-AS2 is a long non-coding RNA (lncRNA) that is associated with the MNX1 gene on the chromosomal locus 7q36.3 [PMC9688723]. It has been found to be about 2.3 kbp long [PMC10152875]. MNX1-AS2 has been shown to be upregulated in the majority of cancers, particularly in adenocarcinomas and seminomas, compared to squamous and non-seminoma tumors [PMC9688723]. It has been suggested that MNX1-AS2 may have diagnostic and prognostic potential in cancer [PMC9688723]. In particular, high expression of MNX1-AS2 has been associated with poor clinical outcomes in various cancers [PMC9688723]. MNX1-AS2 expression has also shown a strong discrimination of disease subtype, such as adenocarcinomas vs. squamous tumors or seminoma vs. non-seminoma tumors [PMC9688723]. The functions and activity of MNX1-AS2 in cancer are still not well understood, as there are limited reports on its role [PMC9688723]. However, it has been found to have potential targets associated with the cell cycle, angiogenesis, epigenetic regulation of gene expression, and chromatin remodeling [PMC9688723]. Overall, the combined expression patterns of MNX1, MNX1-AS1 (another lncRNA associated with the same locus), and MNX1-AS2 have shown diagnostic power in distinguishing normal samples from tumors across various cancer types [PMC9688723].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
ACCCGAAGCUACUGAAUCGGCGCUCUGGGCACCUUAGAUGAACCCGUGCGCCCGCCGUCUGAACCGUCGAGGCGCAGCGCUAGAUGCCUCAGACCGCCCGUGGGUCACAAGUGCAAAGGAGACGUCUGAGUGUCCCUGUUAAACAGGGCCCAUCGCAGGAGGCUUCCUCUCCACAGGAGCCGGCUUUGGUAGCAGUGGAUUGACCCAGAGGCAAGAGGAGAACUGAGGCCAGUCGGGGGCCAGGAAGGGAGGUUCCGGGAAGCCCAGGAGUUGAAGGCUGCAGUGAGCGAGACUGCACCCCUGCACUGUACCCUGGGUGACACAGCAAGACCCCAUCUCUCAAUAAAUAAAAAAUAAUAAAA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications