v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mycobacterium abscessus PreQ1-I sequence secondary structure diagram

Mycobacterium abscessus PreQ1-I sequence URS0000ABD0F6_36809

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CUCGGACUGGUUCGGAAACUUCCCAGAAUAAAAAACUAAGUAUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Enterococcus faecalis PreQ1-I sequence
  2. Enterococcus faecalis V583 PreQ1 (pre queuosine) riboswitch aptamer
  3. Sphingobacterium faecium PCAi_F2.5 PreQ1 riboswitch
  4. Sphingobacterium faecium PreQ1-I sequence
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...