v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Mycobacterium sp. MOTT36Y TPP riboswitch (THI element) secondary structure diagram

Mycobacterium sp. MOTT36Y TPP riboswitch (THI element) URS0000AB65A5_1168287

  • 119 nucleotides
  • 1 database (Rfam)
  • Found in 3 other species
  • ncRNA

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AUUACCAGACACGGGAGUCCCGGGAGCGGGGCUGAGAGUGGGCACAGCCGCGAGGACCUGCCCUUACCGUCACACCUGAUCCGGAUCAUGCCGGCGAAGGGAGGCUCGACAAUGACCGG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

  1. Mycobacterium avium subsp. avium 2285 (S) TPP riboswitch (THI element)
  2. Mycobacterium avium TPP sequence
  3. Mycobacterium intracellulare 1956 TPP riboswitch aptamer (THI element)
  4. Mycobacterium sp. TPP sequence
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...