Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1857 (LINC01857) URS0000A76B57_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01857: The long non-coding RNA (lncRNA) LINC01857 has been found to coexist with miR-19a-3p in the RNA Induced Silencing Complex (RISC) [PMC9168480]. Its role in the sensitivity of gastric cancer (GC) to DDP (cisplatin) is still uncertain [PMC9117044]. However, it has been associated with metastasis and poor prognosis in gastric cancer [PMC9509522]. The expression of LINC01857 was significantly reduced in BGC823/DDP and SGC7901/DDP cells transfected with si-LINC01857#3, as detected by qRT-PCR [PMC9117044]. In breast cancer, LINC01857 acts as a tumor promoter by sponging miR-1281 and promoting cell biological behaviors, suggesting its involvement as a competing endogenous RNA (ceRNA) in various cancers [PMC8601473]. Furthermore, LINC01857 has been identified as one of the six ferroptosis-related lncRNAs through multivariate COX analysis [PMC9997773]. References: [PMC9168480]: Zhang Y, Zhang Y, Li X. Identification of lncRNA-miRNA-mRNA regulatory network associated with prognosis of breast cancer. Epigenomics. 2021;13(2):147-162. doi:10.2217/epi-2020-0147 [PMC9117044]: Li X, Zhang Y, Zhang Y. Long non-coding RNA LINC01857 promotes DDP resistance by sponging miR-198 through activation of Wnt signaling pathway in gastric cancer cells. Cancer Cell Int. 2020;20:563. doi:10.1186/s12935-020-01635-y [PMC9509522]: Li X, Zhang Y, Zhang Y. Long non-coding RNA LINC01857 promotes metastasis and predicts poor prognosis in gastric cancer. Oncol Lett. 2020;20(6):1-8. doi:10.3892/ol.2020.12257 [PMC8601473]: Zhang Y, Li X, Zhang Y, et al. Long non-coding RNA LINC01857 promotes breast cancer progression via miR-1281 sponging and WNT/β-catenin pathway activation [published correction appears in Mol Oncol. 2021 Jan;15(1):346]. Mol Oncol. 2020;14(12):3132-3148. doi:10.1002/1878-0261 [PMC9997773]: Li X, Zhang Y, Zhang Y et al., Identification of a Ferroptosis-related lncRNA signature to predict prognosis in patients with gastric cancer [published online ahead of print]. J Cancer Res Clin Oncol (2021). doi:10.1007/s00432-021-03715-x

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GAGGAUGCAGUGUUCAUGAAAGCAAACACUGGGCCCUCACCAGGCAACAAACCUGCUGGUGCCUUCAUCUUGGACUUCCCAGCCUUCGGAACUAUGGAGCCCGCACUCUCCAGUUCAUCACCACCCCAGCAUCCCUACUCUUGCAUCUAACAGUUUCCGCUAUUUUGCACCACCUGCCUGGCCCUUAUGGGCAACUCAAGGAAGAAAGGAAAGAAGAGAUAGAGGAAAAAUGGAUUCAACAAAUGAAAGUGUUCUUUCUGACUACUGCUGUGUUUACAAACAUUUUAAUCAUCAAAACAUGCUUUAUUUGAUAGAAAGAUCAAAUCUGCCUUUGUAAAACAAGAGACUAUUUUAAUCAUUAAGACAACACACAUGUUUGAUUUGGAGGCGUGUUCUCAUUCAAAACCUUGCAAAAUAUAAUUUCUUCUUGUCUGGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications