Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus musculus (mouse) RIKEN cDNA 0610005C13 gene URS00009AEDBB_10090

  • 663 nucleotides
  • 4 databases (Ensembl, Ensembl/GENCODE, MGI, NONCODE)
  • Found in 1 species
  • lncRNA

Automated summary: This lncRNA sequence is 663 nucleotides long and is found in Mus musculus. Annotated by 4 databases (MGI, Ensembl/GENCODE, Ensembl, NONCODE). Described in 2 papers. Mus musculus (mouse) RIKEN cDNA 0610005C13 gene sequence is a product of NONMMUG037997.2, 0610005C13Rik genes.

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    CUACUAGAGAACUUUGGCCGCAGCUUGUAGACAGCUUAGACGGGACAACGACCAGGGACAGCGAGCAGGAGUAUCAGUCAGCUGGUUGCUGCCGCUGCUACAACCGACCCAGCCACAGCUGGAAUACCCUCAACCUGGGCAGUGACUACUGUGCUCUACACAGUCAGCGGCUGAAGGGCAGUCUCGUGCCAGCCAUUGAAAAUGCUCAAGGCACACAUCCCUGCUGACCUUCCCCAAGACCAUGGAGAGGCAGCUGAGUCCUUAGUUUGAGGAAGACAGGAUAACAGCCUGUUCCCGCUGCUAGAGGCCAGUGAGAUGGAGAGGCUUGCAGAGGUCACUGAUCAAUGGAUCACAGACUCUCAAGCUCAGCAGUGGUGGCCCAGGACUUUAAUUCUAGGACUCAGAAGGCAGAGGCGGGCAGAGUUCGAGGCCAACCUGGUGGUCUACAGAGCAACGGGACAGCUGGGAGUAUGCAGUGAAACCCUACCUCGAAAAGACAAACAAACAAACGAAAUAUCAUAGAUUCUCCAUCUAUGACACCGCUUGACACCAUCGAUGGCUGCUGUGUCGAGCCUCACUUCUGCCAGGCCGUCCUUAGUUCUGGGACCACAGGGACCCAGGCUCUGCUGUGAAGAUCCUGCGCGGGAACGGUCCCGACCUGCC

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.