RNA from Saccharomyces cerevisiae S288C (PDB 6HLQ, chain R)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

RNA from Saccharomyces cerevisiae S288C (PDB 6HLQ, chain R) URS00008FED36_559292

20 nucleotides
1 database (PDBe)
Found in 4 other species
5 publications
transcript

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UAUAUGCAUAAAGACCAGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Brassica oleracea RNA (5'-R(*UP*AP*UP*AP*UP*GP*CP*AP*UP*AP*AP*AP*GP*AP*CP*CP*AP*GP*GP*C)-3') from Brassica oleracea (PDB 8HIM, chain P)
synthetic construct RNA, DNA-RNA ELONGATION SCAFFOLD from synthetic construct (PDB 5FLM, chain P)
Saccharomyces cerevisiae RNA from Saccharomyces cerevisiae (PDB 5M5X, chain R)
Homo sapiens RNA, nucleic acid scaffold from Homo sapiens (PDB 9EHZ, chain P)

Relationships

Molecular Relationships

Publications