v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
P-site tRNA from Oryctolagus cuniculus (PDB 6T59, chain 23) secondary structure diagram

P-site tRNA from Oryctolagus cuniculus (PDB 6T59, chain 23) URS0000868530_9986

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GUCUCCGUAGUGUAGCGGUUAUCACGUUCGCCUAACACGCGAAAGGUCCUCGGUUCGAAACCGGGCGGAAACACCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Homo sapiens E tRNA from Homo sapiens (PDB 7A5G, chain j)
  2. Sus scrofa P-site tRNA from Sus scrofa (PDB 8RJB, chain q)
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications