v27

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Faecalibacterium prausnitzii A2-165 PreQ1-III (pre queuosine) riboswitch aptamer secondary structure diagram

Faecalibacterium prausnitzii A2-165 PreQ1-III (pre queuosine) riboswitch aptamer URS0000868518_411483

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GAGCAACUUAGGAUUUUAGGCUCCCCGGCGUGUCUCGAACCAUGCCGGGCCAAACCCAUAGGGCUGGCGGUCCCUGUGCGGUCAAAAUUCAUCCGCCGGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

  1. Faecalibacterium prausnitzii preQ1-III sequence
  2. human gut metagenome PreQ1-III (pre queuosine) riboswitch aptamer
  3. unidentified Human gut preQ1-III sequence
  4. unclassified sequences PreQ1-III Riboswitch preQ1-III sequence
  5. uncultured Faecalibacterium sp. Uncultured Faecalibacterium preQ1-III sequence
 Relationships

Molecular Relationships

 2D structure

Loading 2D structure...

 Publications