SAM-I RIBOSWITCH from Caldanaerobacter subterraneus subsp. tengcongensis (PDB 2YDH, chain A)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

SAM-I RIBOSWITCH from Caldanaerobacter subterraneus subsp. tengcongensis (PDB 2YDH, chain A) URS000080E1B3_119072

94 nucleotides
1 database (PDBe)
Found in 2 other species
3 publications
1. mRNA region
2. riboswitch

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

GGCUUAUCAAGAGAGGUUUAGGGACUGGCCCGACGAAACCCGGCAACCAGAAAUGGUGCCAAUUCCUGCAGCGGAAACGUUGAAAGAUGAGCCG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

Caldanaerobacter subterraneus SAM riboswitch aptamer (S box leader)
unclassified sequences SAM-I RIBOSWITCH SAM-I sequence

Relationships

Molecular Relationships

Publications