5S ribosomal RNA from Escherichia coli (PDB 5U9G, chain 02)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

5S ribosomal RNA from Escherichia coli (PDB 5U9G, chain 02) URS000080E133_562

119 nucleotides
1 database (PDBe)
Found in 6 other species
44 publications

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGCCUGGCGGCCGUAGCGCGGUGGUCCCACCUGACCCCAUGCCGAACUCAGAAGUGAAACGCCGUAGCGCCGAUGGUAGUGUGGGGUCUCCCCAUGCGAGAGUAGGGAACUGCCAGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Escherichia coli BL21(DE3) 5S ribosomal RNA from Escherichia coli BL21(DE3) (PDB 9GR1, chain b)
Escherichia coli B 5S ribosomal RNA from Escherichia coli B (PDB 8B0X, chain b)
Escherichia coli K-12 5S ribosomal RNA from Escherichia coli K-12 (PDB 4V9D, chain CB)
Escherichia coli str. K-12 substr. MDS42 5S ribosomal RNA from Escherichia coli str. K-12 substr. MDS42 (PDB 4U1V, chain DB)
Escherichia coli str. K-12 substr. MG1655 5S ribosomal RNA from Escherichia coli str. K-12 substr. MG1655 (PDB 4WF1, chain DB)
Franconibacter helveticus 5S rRNA

Relationships

Molecular Relationships

Publications