Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

RNA (35-MER) from synthetic construct (PDB 6CF2, chain G) URS000080DFEA_32630

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GGCUGGACUCGUACUUCGGUACUGGAGAAACAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

  1. unclassified sequences Aptamer that binds to HIV-1 Rev93
Relationships

Molecular Relationships

Publications