RNA operator hairpin from None (PDB 4L8H, chain R)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

RNA operator hairpin from None (PDB 4L8H, chain R) URS000080DDA5_32630

20 nucleotides
1 database (PDBe)
Found in 1 other species
8 publications
transcript

mRNA interactions total

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

AUGCAUGUCUAAGACAGCAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 1 other species

Escherichia phage MS2 5'-R(*AP*CP*AP*UP*GP*AP*GP*GP*AP*UP *UP*AP*CP*CP*CP*AP*UP*GP*U)-3' from Escherichia phage MS2 (PDB 2BS1, chain R)

Relationships

Molecular Relationships

Publications