Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Saccharomyces cerevisiae YJM1307 RPM1 URS00007E9EB6_1294345

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AGAUAUUUAUAUUAUUAAUAGGAAAGUCAUAAAUAUAUAAAUUAUAUUAUAUAAUUAAUAUAAUAAUAAAAUAAAUUAUAUAUUUUAUUUAUAAUAUUAUUUCUUUAUAAGAUAAAAUAUUAUCUGAUGAAUAAUUAGAUUGAAUAAUAUUUAUAAAGAAAUAUAUAUAAAAAGUCAUUAUAUAAAUUUAAUUAUAAUUUAAAUAAAUUUUAUAUAAAUUAAUAUAAUAUUAAUAAAGUAAUUAGUAUAAAUAAAUAAUAUGAAAAUAAAACUUAAUAAAUAUAUAAAUAUAGUCCGGCCCGCCCCCCCGCGGCGGGCGGACCCCGAAGGAGUGAGGGACCCCUCCCUAAUGGGAGGGGGACCGAACCCCUUUUUAAGAAGGAGUCCAUAUAUAUAUAUUAAUAAAAAAAAGUAAUAUAUAUAUAUAUAUUGGAAUAGUUAUAUUAUUAUACAGAAAUAUGCUUAAUUAUAAUAUAAUAUCCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

  1. Saccharomyces cerevisiae S288C RNase P Mitochondrial
  2. Saccharomyces cerevisiae YJM1478 RPM1