Papio hamadryas (hamadryas baboon) microRNA pha-mir-30c precursor

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Papio hamadryas (hamadryas baboon) microRNA pha-mir-30c precursor URS00007E4F75_9557

62 nucleotides
2 databases (ENA, miRBase)
Found in 9 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

UGUAAACAUCCUACACUCUCAGCUGUGGAAAGUAAGAAAGCUGGGAGAAGGCUGUUUACUCU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 9 other species

Ailuropoda melanoleuca microRNA 30c-2 (ENSAMEG00000022913.2)
Canis lupus familiaris microRNA cfa-mir-30c precursor (cfa-mir-30c-2)
Homo sapiens (human) Hsa-Mir-30-P2b_pre stem-loop
Loxodonta africana (African savanna elephant) microRNA 30c-2 (ENSLAFG00000026839.1)
Macaca mulatta Mml-Mir-30-P2b_pre stem-loop
Nomascus leucogenys (northern white-cheeked gibbon) microRNA nle-mir-30c precursor
Ursus americanus miRNA (ENSUAMG00000015587.1)
Ursus maritimus miRNA (ENSUMAG00000011912.1)
Ursus thibetanus thibetanus (Asiatic black bear) microRNA 30c-2 (ENSUTTG00000009599.1)

2D structure