v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1697 (LINC01697) URS00007E48F7_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01697: LINC01697 is a long non-coding RNA (LncRNA) that has been found to have diagnostic value for non-small cell lung cancer (NSCLC) [PMC7327696]. It has been shown to be significantly correlated with NSCLC stage and survival time, suggesting its potential as a biomarker for NSCLC [PMC7327696]. Additionally, LINC01697 has been implicated in the development of lung squamous cell carcinoma [PMC8268976]. The study by Liu et al. analyzed the transcriptional profiling of LncRNAs and identified LINC01697 as a potential target for drug development in the treatment of NSCLC [PMC7327696]. The accurate diagnosis value of LINC01697 for NSCLC indicates its potential as a diagnostic tool in clinical settings. The correlation between LINC01697 and NSCLC stage and survival time suggests that it may have prognostic value as well. Furthermore, the involvement of LINC01697 in the development of lung squamous cell carcinoma highlights its role in cancer progression [PMC8268976]. This finding suggests that targeting LINC01697 could be a promising approach for therapeutic interventions in lung squamous cell carcinoma. In conclusion, LINC01697 is an important lncRNA with diagnostic value for NSCLC and potential as an anti-NSCLC target for drug development. Its correlation with NSCLC stage and survival time, along with its involvement in lung squamous cell carcinoma, further emphasize its significance in cancer research [PMC7327696] [PMC8268976].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
AGUUUUAAAAAUGUAAGUUUCUCUGCACAAGCUCUCUUUUUGCCUGCUGCCAUCCACGUAAGAUGUGACUUGCACCUCCUUGUCUUCUGCCACGAUUGUGAGGCUUCCCCAGCCAUGUGGAACUACAUCUACCCCUGGAGAAAGAGCCCAAUGAGAAGUAAUCUCUGAAGCCCAGAUUUCCUAAGGAUGAAGCUUCAGGAGAGGCCUUAUCAAUCCUGACAACAAACUUUUCUCGUCAAUUUAGUUUCAUUUAAUGGAAGUUUUAAAUGUGUAAAGUUCAGAAGGCUAUUAAAAUUGGUUCCAGCUAUCUAAGAUACACACACAACCACACACGCGCACACACGAAUACAAAUAUGCCUUCCCAAUCAUCUCCCAAAGUCUCAACUCAUUCCAGCGUUAACUCAAAGACCAAAAUUCAAAGUCUCAUCUGAAACAAGGUGUUGCCAAAGGAGAUUAUUAUUUGAGUCAGAGGACUGGGAGAAGCAGACCUACCCUCGAUCUGGGUGGGUGUCAUCUAGUCAGCUGCCAGUGUGGCUAGAAUGAAGCAGGCAGAAGUUGGAAAGAGCAGACCUGCUGAGUCUUCUGGCCCUCACCGUUCUCCCGUGCUGGAUUCUUCUGGCCCUCAAACAUCAGACUCCACGUUCUUCAGCUUUUGGACUCAUGGACUUACACCAGUGGUGUGCCAGGGCCUCUUGAGCCUUUGGUCACAGACUGAAGGCUACACUGUCAGCUUCUCUAAUUUUGAGGUUUUGGGACUCAGACUGAUCCACCACUGGCUUCCUUGCUCCUCAACUUGCAGAUGGCUUCUCACGGGACUUGACUUUAUGAUCAUACUUGGCCAAUAAGAUGUUCCUGCCUAAGACUUUGAAUCUGGAAUGGGGAACACAGAGAACAUGAGCAACGAAGAAUUAUUCACAGCACAGCACAGCAGUGCUGACAGCAUCGACAGUCCUGUGGUGCCAGCAAGAAUCCAAAAGAAGUGUCCUACAUAAAUUCCCUUAAUCACUGACCAUUUAAUGAGGCUGAUUCAGCCUCAUACAAAUUUUGUAUGCUUCUUCAUACAAUUUUUAAUUGUGCUGUAAAAGUUAACCAGAGACAAUUUCUGUUGCUUGCACACAGUAAGUUGACUAAGCAAAAAAAUUCAGGAGAGAUUAUUUUAUAGAAGUCAAUGCAAAUGCAUUAAUUUACAAGAAGUGAAACUGCAAGUUCACUUUGCUGCCUUAUGGCCAGCAUAUUCUCUUACAAGGGAAGUCUAUAUGGCAAUCUGUGUUAUGAUCAGAAGAUUUGGGAAAGAUGGAAUCUGUGAGAGAGUUUUAUGACACACGGUUACAACUGAUCACAGGAUCAAACACUAAAACUCCAAUAUAUAUAUUUAUUCUUAUUAGCAAAGCUUUUAUGCUAUGGAGGAAAAAGAAAAAGAAAUAAGAAAUUCUGAGUUUCUCUAAACUUCCAGUAUGUGGAUGAGUUAAAAACUAUGUCAUCUUGGAUUCCCCAUUUUAAAUAUUUCAUAAUAAUGCAUUAUAAUUGGUACAUGUUAAUAUCAAUUUUUUCUUUUGCUGUUUUUGAAGUGGUGUGAAUCACCUGUAACAAGGUUUCCUUAUCAUCCAUUUAAUUAUUGUCCUAUAAUAUACUUUUCAAUACAGCAACUACUUUUUAUGUUUUGGGAUUACUUUUACUAUUGUUAGAUAAAACCUAUGGUUGAUUGUGUGCCUCUAGAAGAACUUCAAAAGUACAAUAUAAAUCUUGCUAACA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications