Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) microRNA rno-mir-466c precursor URS00007E44EF_10116

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

rno-mir-466c: Rno-mir-466c is a miRNA that has been found to be significantly deregulated in various experimental conditions. In a study comparing miRNA expression changes in different groups, rno-mir-466c showed similar downregulation in both the SL- and PH-group at the same postoperative time point, suggesting its involvement in the response to surgical procedures [PMC4198680]. Additionally, rno-mir-466c was found to be downregulated following PH, SL, and anesthesia compared to non-treated animals [PMC4198680]. Interestingly, rno-mir-466c was significantly upregulated following isoflurane anesthesia compared to untreated animals [PMC4198680]. This miRNA was also found to be downregulated in DHT-treated rats, suggesting its association with thecal hyperandrogenesis [PMC3682887]. Overall, these findings suggest that rno-mir-466c plays a role in various physiological processes and may be regulated by different factors. However, further research is needed to fully understand its specific functions and mechanisms of action.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
CAUGUGUGUAUGUGAUGUGUGUAUGUACAUGUGUGUAUAUGAAGAAACAUAUACAUGCACACAUACACACACACUGGCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications