v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1287 (LINC01287) URS00007E40BE_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01287: LINC01287 is a long non-coding RNA (lncRNA) that has been studied in relation to colon cancer and gastric cancer [PMC6201358]. In a study, it was found that inhibiting miR-298 increased the expression of LINC01287 [PMC6201358]. The study also used PCR to measure the enrichment of DNA fragments of the putative c-JUN-binding sites within the LINC01287 promoter [PMC6044102]. However, it is important to note that the function of LINC01287 in colon cancer was only evaluated in cell lines and nude mice, and further studies are needed using patient-derived xenografts or transgenic mice [PMC8259379]. Additionally, it was discovered that down-regulating LINC01287 inhibited gastric cancer cell invasion in vitro and reduced lung metastasis in vivo [PMC6201358].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
CGGCCGCUGUGGCUCCACAUGGCGACCCCUCCCUGGAUGGCGAAGGUGCCCUCUAGCUCCUCCAACUGGAUGACGACUGAAGAGGCCCAGGCUCGGGAACCCCUCUCACCCUUGCCGAGCCCAGGGUAAUGCUUCAGGUAGCGGAGACAAAUGAAGACACUCGACCAUCUCUAAAUGCUACCAAACACAUAGAGUCUACUCUGAAUGCAGAUACUGCUCUCAUAAAAAUUCUGCAAAGGAGGAAGGGGUUGGUGCAGAACUGUUCCGAUGCUGAUCAACUGAGAUGCAAAACCCAUGUUCACAUCAUGAGUGAGUCUUCUAACUCGGACAAUGCAAUCAACAAAUUCUAAGACCAAAUUCCGGUGGCACUGGCUCCAAAGCUCCUGAGUGUGGAAGGAGGUGAACAGGGAAAAGCAGAGAGGACAAAAGUCACAUCCCCUCCCCACAGACCCAUACUGGGGAAGGGUGGAAGAUUUAGCUGCGAGUCAAGUUCAGAAUUUUGAUUAACAUCUUGGCAUGCACAUUCGAAUUUCAGAAUCAAGACUGUUGGCCAUAAAAAAUGACUAUAGCCUUGUGUAUUACCUGAACUGAGCAGUAAAAAAAAAGUCAUGGUCCUUCUGGGGCUUUUAUUCUGAGACAGGAACCCUGAACAGGCAGGAGAAAGGGAAUGUUGACAGAGAAACAAAGACAGUUGGCGACACACGCUGACCGCCAUGCGGACGUCCAUCAAACCCAGCACUGGCCCUGGGUACGUGCGCCUUUGCUAUUACCCCAAUACAUUUUCUUCUGCAGAGCAAGCAACAGAACACAUGCAGACCUUAAUAAAUACCACUGGGUAAUGUGACAAUGGCCAAACUCUCCUCACGGGGGAGAGAGUGUCCCCCAGUUUUGCUCCCUUUUAAUUUCCAGGGUUCAUAAGUAGCUCUAAAGCUUUGCUCUACAAGGUUGAUACAUACGAUAUUAAUGUUUCCCCUAAGCAGUAUAACAUAAAUAUAUUUGCUAUCUUGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications