Pteropus vampyrus (large flying fox) microRNA 199a-2 (ENSPVAG00000024628.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pteropus vampyrus (large flying fox) microRNA 199a-2 (ENSPVAG00000024628.1) URS00007E3C1C_132908

59 nucleotides
1 database (Ensembl)
Found in 6 other species
20 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences

CCAGUGUUCAGACUACCUGUUCAGGACAAUGCCGUUGUACAGUAGUCUGCACAUUGGUU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Canis lupus familiaris microRNA cfa-mir-199 precursor (cfa-mir-199-2)
Echinops telfairi (small Madagascar hedgehog) miRNA (ENSETEG00000020509.1)
Erinaceus europaeus (western European hedgehog) miRNA (ENSEEUG00000016200.1)
Myotis lucifugus (little brown bat) microRNA 199a-2 (ENSMLUG00000018090.1)
Ochotona princeps (American pika) microRNA 199a-2 (ENSOPRG00000017908.2, ENSOPRG00000018938.1)
Procavia capensis microRNA 199a-2 (ENSPCAG00000019902.1)

2D structure

Publications