v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Neovison vison (American mink) miRNA (ENSNVIG00000023508.1) secondary structure diagram

Neovison vison (American mink) miRNA (ENSNVIG00000023508.1) URS00007E3971_452646

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
ACUCUAUGAAUCUAGUGGAAACAUUGCUGCACAAACUAGAUUAUGGAUACCAGUGUGCGGAAAUGCUUCUGCUACAUUUUUAGGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 5 other species

  1. Canis lupus dingo (dingo) miRNA (ENSCAFG00020007810.1, ENSCAFG00020022096.1, ENSCAFG00020022097.1)
  2. Canis lupus familiaris (dog) microRNA cfa-mir-147 precursor
  3. Mustela putorius furo miRNA (ENSMPUG00000020420.1)
  4. Zalophus californianus (california sea lion) miRNA (ENSZCAG00015004940.1)
 2D structure