v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Rattus norvegicus (Norway rat) Rattus_norvegicus piRNA piR-rno-62963 URS00007E385F_10116

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
UCCCUGAGACCCUUUAACCUGU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 8 other species

  1. Canis lupus familiaris (dog) cfa-miR-125a
  2. Capra hircus chi-miR-125a-5p
  3. Mus musculus (house mouse) Mus_musculus piRNA piR-mmu-72418
  4. Nomascus leucogenys (northern white-cheeked gibbon) nle-miR-125a
  5. Ornithorhynchus anatinus Oan-Mir-10-P3b_5p (mature (guide))
  6. Pteropus alecto (black flying fox) pal-miR-125a-5p
  7. Sarcophilus harrisii Sha-Mir-10-P3b_5p (mature (guide))
  8. Tursiops truncatus miR-125a