Canis lupus dingo (dingo) microRNA 653 (ENSCAFG00020011659.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Canis lupus dingo (dingo) microRNA 653 (ENSCAFG00020011659.1) URS00007E37EE_286419

91 nucleotides
1 database (Ensembl)
Found in 3 other species
6 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UCAUUCCUUCAGUGUUGAAACAAUCUCUAUUGAACCAGGCUCCAAACCAAGUUCACUGGAGUUUGUUUCAAUAUUGCAAGAAUGAUAAGAU

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Canis lupus familiaris (dog) microRNA cfa-mir-653 precursor
Vulpes vulpes miRNA (ENSVVUG00000015496.1)

Publications