Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Macaca mulatta (Rhesus monkey) Mml-Mir-216-P2b_5p (mature (co-guide)) URS00007E375B_9544

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UAAUCUCAGCUGGCAACUGUGAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 33 other species

  1. Alligator mississippiensis Ami-Mir-216-P2b_5p (mature (guide))
  2. Anolis carolinensis Aca-Mir-216-P2b_5p (mature (guide))
  3. Bos taurus (cattle) Bta-Mir-216-P2b_5p (mature (guide))
  4. Branchiostoma belcheri (Belcher's lancelet) bbe-miR-216-5p
  5. Branchiostoma floridae bfl-miR-216-5p
  6. Callorhinchus milii Cmi-Mir-216-P2b_5p (mature (guide))
  7. Canis lupus familiaris (dog) Cfa-Mir-216-P2b_5p (mature (guide))
  8. Cavia porcellus (domestic guinea pig) cpo-miR-216a-5p
  9. Chrysemys picta bellii (western painted turtle) Cpi-Mir-216-P2b_5p (mature (guide))
  10. Columba livia Cli-Mir-216-P2b_5p (mature (guide))
  11. Danio rerio Dre-Mir-216-P2b_5p (mature (guide))
  12. Dasypus novemcinctus (nine-banded armadillo) dno-miR-216a-5p
  13. Echinops telfairi (small Madagascar hedgehog) Ete-Mir-216-P2b_5p (mature (guide))
  14. Gallus gallus Gga-Mir-216-P2b_5p (mature (guide))
  15. Gekko japonicus Gja-Mir-216-P2b_5p (mature (guide))
  16. Homo sapiens Hsa-Mir-216-P2b_5p (mature (guide))
  17. Latimeria chalumnae Lch-Mir-216-P2b_5p (mature (guide))
  18. Lepisosteus oculatus (spotted gar) Loc-Mir-216-P2b_5p (mature (guide))
  19. Microcaecilia unicolor Mun-Mir-216-P2b_5p (mature (guide))
  20. Monodelphis domestica Mdo-Mir-216-P2b_5p (mature (guide))
  21. Mus musculus (house mouse) Mmu-Mir-216-P2b_5p (mature (guide))
  22. Ophiophagus hannah (king cobra) oha-miR-216-5p
  23. Ornithorhynchus anatinus Oan-Mir-216-P2b_5p (mature (guide))
  24. Oryctolagus cuniculus ocu-miR-216a-5p
  25. Python bivittatus Pbv-Mir-216-P2b_5p (mature (guide))
  26. Rattus norvegicus (Norway rat) Rno-Mir-216-P2b_5p (mature (guide))
  27. Sarcophilus harrisii Sha-Mir-216-P2b_5p (mature (guide))
  28. Scyliorhinus torazame (cloudy catshark) Sto-Mir-216-P2b_5p (mature (guide))
  29. Sphenodon punctatus (tuatara) Spt-Mir-216-P2b_5p (mature (guide))
  30. Sus scrofa (pig) ssc-miR-216
  31. Taeniopygia guttata (zebra finch) Tgu-Mir-216-P2b_5p (mature (guide))
  32. Xenopus laevis (African clawed frog) xla-miR-216-5p
  33. Xenopus tropicalis (tropical clawed frog) Xtr-Mir-216-P2b_5p (mature (guide))