Mus spretus (algerian mouse) predicted gene, 38670 (MGP_SPRETEiJ_G0008512.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus spretus (algerian mouse) predicted gene, 38670 (MGP_SPRETEiJ_G0008512.1) URS00007B1A65_10096

77 nucleotides
1 database (Ensembl)
Found in 3 other species

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGCUGAGUCAGAGGCACAGAAUUAGGCCCGACCUACUCUGGGGUAGGGUCUGUUCUGUGUCCUCCUGACUGCCUGGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Mus caroli (Ryukyu mouse) predicted gene, 38670 (MGP_CAROLIEiJ_G0008089.1)
Mus musculus (house mouse) microRNA mmu-mir-9769 precursor
Mus spicilegus predicted gene, 38670 (ENSMSIG00000005615.1)