Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 7976 (ENSGGOG00000043570.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 7976 (ENSGGOG00000043570.1) URS000075EFB5_9595

66 nucleotides
1 database (Ensembl)
Found in 3 other species
2 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

UGCCCUGAGACUUUUGCUCUAAUAAUUUAUUCUAAUAAUAAUUUAGAUCAAAAGCCUCAGGGCAGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Homo sapiens (human) microRNA hsa-mir-7976 precursor
Pan paniscus microRNA 7976 (ENSPPAG00000016641.1)
Pan troglodytes microRNA 7976 (ENSPTRG00000050486.1)

Publications