Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.
Homo sapiens (human) microRNA hsa-mir-3193 precursor secondary structure diagram

Homo sapiens (human) microRNA hsa-mir-3193 precursor URS000075EE94_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR3193: MIR3193 is a microRNA that has been identified as one of the novel microRNAs in melanomas [PMC8776809]. In breast cancer, the promoter regions of three genes (MIR124-2, RP11-713P17.4, and NUS1P3) were hypermethylated in brain metastases (BBM), while three genes (MIR3193, CTD-2023M8.1, and MTND6P4) were hypomethylated in BBM compared to primary tumors [PMC8776809]. The promoter regions of RP11-713P14.4, MIR3193, MTND6P4, and CTD-2023M8.1 were analyzed in primary breast tumors [PMC8776809]. MIR3193 was found to be frequently upregulated in glioma compared to normal brain tissue [PMC8776809][PMC8776809]. MIR3193 and MTND6P4 were commonly unmethylated in BBM and their originating primary breast tumors [PMC8776809]. These genes are non-protein coding genes including microRNAs (MIR3193 and MIR124-2), long intergenic non-coding RNA (lincRNA) genes (RP11-713P17.4 and CTD-2023M8.1), and pseudogenes (MTND6P4 and NUS1P3) [PMC8776809]. In BBM samples, CTD-2028M8.1 was methylated in 26%, MIR3193 was methylated in 29%, while MTND6P4 was unmethylated [PMC8776809]. The study identified a panel of six novel non-protein coding genes that are epigenetically dysregulated in cancer metastases including RP11-713P17.4, NUS1P3, MIR3193, MTND6P4, and CTD-2023M8.1 [PMC8776809]. MIR3193 and MTND6P4 have metastatic promoter function and are silenced in normal breast tissues and primary breast tumors due to methylation [PMC8776809]. MIR3193, MTND6P4, and CTD-2023M8.1 are hypomethylated in BBM compared to primary tumors and normal breast tissues [PMC8776809]. In a study on primary breast tumors and circulating DNA isolated from patients' serum, MIR3193 showed a similar methylation status in 50% of the samples [PMC8776809]. In another study on brain metastases compared to primary brain tumors, MIR3193 was found to be hypomethylated [PMC10109215].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
UCCUGCGUAGGAUCUGAGGAGUGGACGAGUCUCAUUACCCAGCUCCUGAGCAGGA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 2 other species

2D structure Publications