Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-767 precursor URS000075ED21_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR767: MIR767 is a microRNA that has been studied in various contexts. In one study, the level of MIR767 was explored in senescent vascular endothelial cells-derived exosomes and its expression levels were examined after co-culture with skin fibroblasts [PMC9908644]. Additionally, a 214.11-kb duplication in the chromosomal Xq28 region, which includes the GABRA3, MIR105-1, MIR767, and MIR105-2 genes, was identified in a proband via microarray analysis and was inherited from his healthy mother [PMC6894506]. This duplication has been associated with mental development abnormalities [PMC6894506]. In another study comparing miRNA expression levels in PANC-1 cells and hTERT-HPNE cells, it was found that MIR767 showed higher expression levels in PANC-1 cells compared to hTERT-HPNE cells [PMC3849454]. The function of MIR767 is largely unknown at this time [PMC3849454]. Additionally, another miRNA called MIR1269 showed similar expression patterns to MIR767 in the same study. However, its function is also largely unknown except for a potential role during differentiation of human embryonic stem cells [PMC3849454].

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
GCUUUUAUAUUGUAGGUUUUUGCUCAUGCACCAUGGUUGUCUGAGCAUGCAGCAUGCUUGUCUGCUCAUACCCCAUGGUUUCUGAGCAGGAACCUUCAUUGUCUACUGC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Publications