Pongo abelii (Sumatran orangutan) microRNA 3667 (ENSPPYG00000040696.1) URS000075EBAC_9601

• 74 nucleotides
• 2 databases (ENA, Ensembl)
• Found in 4 other species
• 3 publications
• 1. sncRNA
  2. small regulatory ncRNA
  3. miRNA

Genome locations

Gene Ontology annotations

Ancestor Chart

Loading ontology ancestors... Failed to load QuickGO Ancestor chart

×

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

{{ showSequence ? "Hide sequence" : "Show sequence" }}

Copy as RNA Copy as DNA

Search for similar sequences

UGAGGAUGAAAGACCCAUUGAGGAGAAGGUUCUGCUGGCUGAGAACCUUCCUCUCCAUGGGUCUUUCAUCCUCA

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

1. Homo sapiens (human) microRNA hsa-mir-3667 precursor
2. Nomascus leucogenys microRNA 3667 (ENSNLEG00000021339.2)
3. Pan paniscus microRNA 3667 (ENSPPAG00000005743.1)
4. Pan troglodytes microRNA 3667 (ENSPTRG00000046345.1)

Publications Download

• FASTA
• JSON