Sinocyclocheilus anshuiensis (blind barbel) miRNA (ENSSANG00000012719.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Sinocyclocheilus anshuiensis (blind barbel) miRNA (ENSSANG00000012719.1) URS000075EA85_1608454

83 nucleotides
1 database (Ensembl)
Found in 4 other species
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GGUUUUUGCUCUUUGUGUUCACAGUGGACCUUGAUUUAAUUUCAAUACAAUUAAGGCACGCGGUGAAUGCCAAGAGAGAAGCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 4 other species

Carassius auratus (goldfish) miRNA (ENSCARG00000020609.1, ENSCARG00000042353.1, ENSCARG00000063740.1)
Danio rerio (zebrafish) microRNA dre-mir-124 precursor (dre-mir-124-4)
Sinocyclocheilus grahami miRNA (ENSSGRG00000022476.1, ENSSGRG00000034817.1, ENSSGRG00000034818.1)
Sinocyclocheilus rhinocerous (horned golden-line barbel) miRNA (ENSSRHG00000046255.1)