Mus spicilegus (steppe mouse) microRNA 3097 (ENSMSIG00000022861.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Mus spicilegus (steppe mouse) microRNA 3097 (ENSMSIG00000022861.1) URS000075E91F_10103

67 nucleotides
1 database (Ensembl)
Found in 3 other species
2 publications

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

ACACAGGUGGGAAGUGUGUGUCCAGUGGGUGUGUCUACAGAUCUGCUCAGACCUUUCUACCUGUCAG

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 3 other species

Mus caroli microRNA 3097 (MGP_CAROLIEiJ_G0007943.1)
Mus musculus microRNA mmu-mir-3097 precursor
Mus spretus microRNA 3097 (MGP_SPRETEiJ_G0008343.1)

Publications