v24

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) long intergenic non-protein coding RNA 1117 (LINC01117) URS000075E811_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

LINC01117: LINC01117 is a long non-coding RNA (lncRNA) that has been studied in various cancer types, including lung adenocarcinoma (LUAD) and bladder cancer (BCa). In LUAD, LINC01117 has been identified as an independent unfavorable prognostic indicator and its upregulation has been observed in LUAD cell lines [PMC9986451]. In BCa, LINC01117 is part of an 8-lncRNA-based signature that predicts patient survival outcomes and the migration of BCa cells [PMC8177463]. Additionally, LINC01117 has been found to have diagnostic potential in tissue samples of various cancer types [PMC9288825]. In endothelial cells (ECs), LINC01117 physically contacts expressed HOXD genes and is activated during cecum budding [PMC6921469]. Furthermore, LINC01117 is coexpressed with several differentially expressed mRNAs in a prognostic signature for gastric cancer [PMC7220432]. Overall, the studies suggest that LINC01117 plays a role in cancer progression and may have diagnostic and prognostic value. However, further research is needed to fully understand the functional mechanisms of LINC01117 in different cancer types.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences 
GGAACCUCGGCCCCAUGCGGGCGGGCCAGCGCGGCCAGGAGGGCCGGGAAGAGGGGUCCCCGGGGCCCCGGAUGCGCUGAACUCCGGGGAGGGGAUGGGCAGGAGAGAGAGCACACUCCUGGAGCCGCGACGUCCAAACCCGGACGCACUUGAACCCGCAGCGAGGCCCGUGGCUCGCGGCCUUCGGAGAGCACCCGCGCCCCGCGCAGACCGGACGCCGGCCUUGCCCGAUCCUCGGCAUCCUUCGGCGGGGCGAUACGUGAUCAUUUAACACACGGGUGUUAAGUUCAUUCUUGCUGCAAAAGAAGGCCAUUGUACCUCCUGACCCUGAAAGCAAGAUGAAGUCACUGAGACACCAAAGGUUAAUUGCUUGCCCAAAGCCAUGUAGCAACUUGGUUGAAGUUACUUUAGUGUCGAAAGCUCCACAUAUGUGCUUUUCGCAAAAUCAAUAGUCACCCCAUGCAAACGAAGAGAUGGUAAUUAGAGAUGGGACAGACCCCAACAUAUCCUUCAUUUGAAGAUAGAAUAAAUUCAGCAAGAUACCUAAUUAUUAUCAUCAUCUUUCACAAAAACAUAUGUGAUUUUUCCCCCCUACCCAAAUGUUUUAGUGAAAACUGCAACUGUGCAUUAAAAGGCAGUUUUGCAUGCAUAUAUUC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications