Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-34c precursor URS000075E7C8_9606

  • 77 nucleotides
  • 9 databases (ENA, Ensembl, Ensembl/GENCODE, GeneCards, HGNC, IntAct, MalaCards, miRBase, RefSeq)
  • Found in 16 species
  • transcript

Automated summary: This precursor RNA sequence is 77 nucleotides long and is found in Homo sapiens. Annotated by 9 databases (GeneCards, IntAct, RefSeq, Ensembl, ENA, MalaCards, miRBase, Ensembl/GENCODE, HGNC). Described in 55 papers. Homo sapiens (human) microRNA hsa-mir-34c precursor sequence is a product of hsa-mir-34c precursor, mir-34c precurso, MIR34C, mir-34c precursor, mir-34c genes. Found in the human reference genome.

Interactions 5

According to IntAct, Homo sapiens (human) microRNA hsa-mir-34c precursor interacts with:

IntAct ID Participant Synonyms
EBI-11170231 signor:SIGNOR-C32 3.1.26.3 AGO2:DICER1:TARBP2 EBI-10816154 R-HSA-6789244 RISC-loading complex, TARBP2 variant RLC complex SIGNOR-C32 miRLC complex microRNA loading complex tarbp2-risc_complex_human
EBI-11169782 Q9UKV8 AGO2 Argonaute RISC catalytic component 2 EBI-528269 EIF2C2 Eukaryotic translation initiation factor 2C 2 PAZ Piwi domain protein Protein slicer Q8TCZ5 Q8WV58 Q96ID1 Q9UKV8 ago2_human
EBI-11169775 Q9UPY3 A7E2D3 B3KRG4 DICER DICER1 E0AD28 EBI-395506 HERNA Helicase with RNase motif KIAA0928 O95943 Q9UPY3 Q9UQ02 dicer_human
EBI-11169814 Q9UPY3 A7E2D3 B3KRG4 DICER DICER1 E0AD28 EBI-395506 HERNA Helicase with RNase motif KIAA0928 O95943 Q9UPY3 Q9UQ02 dicer_human
EBI-11170245 Q9UPY3 A7E2D3 B3KRG4 DICER DICER1 E0AD28 EBI-395506 HERNA Helicase with RNase motif KIAA0928 O95943 Q9UPY3 Q9UQ02 dicer_human

Genome locations

Sorry, there was a problem loading genome locations from server. Please try again and contact us if the problem persists.

This sequence is found in {{ locations.length }} genome :

Go to location Chromosome Start End Strand Ensembl UCSC Sequence identity
Loading genome locations...
Failed to load data from server
No genome locations known
loading browser
  • Can't view - strange chromosome name
  • {{ location.chromosome }} {{ location.start | number }} {{ location.end | number }} {{ location.strand == "1" ? "forward" : "reverse" }} {{ location.ensembl_division.name.replace('EnsemblVertebrates', 'Ensembl') }} UCSC 100% {{ location.identity * 100 | number:0 }}%

    No genome locations found for this sequence. Learn more →

    Gene Ontology annotations

    Sequence

    Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

    AGUCUAGUUACUAGGCAGUGUAGUUAGCUGAUUGCUAAUAGUACCAAUCACUAACCACACGGCCAGGUAAAAAGAUU

    Taxonomic tree

    View annotations in different species by clicking on species names.

    Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

    This sequence is found in 15 other species

    1. Ailuropoda melanoleuca (giant panda) miRNA
    2. Aotus nancymaae miRNA
    3. Gorilla gorilla gorilla (Western Lowland Gorilla) microRNA 34c
    4. Ictidomys tridecemlineatus microRNA 34c
    5. Microcebus murinus miRNA
    6. Mustela putorius furo (Domestic ferret) miRNA
    7. Octodon degus (Degu) miRNA
    8. Otolemur garnettii (small-eared galago) miRNA
    9. Pan paniscus (bonobo) miRNA
    10. Panthera pardus microRNA 34c
    11. Pan troglodytes (chimpanzee) ptr-mir-34c
    12. Pongo abelii microRNA 34c
    13. Pongo pygmaeus (Bornean orangutan) microRNA ppy-mir-34c precursor
    14. Propithecus coquereli (Coquerel's sifaka) miRNA
    15. Pteropus vampyrus microRNA 34c
    16. Saimiri boliviensis boliviensis miRNA
    17. Tupaia belangeri microRNA 34c