Pan paniscus (bonobo) microRNA 371a (ENSPPAG00000015547.1)

Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Pan paniscus (bonobo) microRNA 371a (ENSPPAG00000015547.1) URS000075E7B1_9597

67 nucleotides
1 database (Ensembl)
Found in 6 other species
3 publications
1. transcript
2. pre-miRNA

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

GUGGCACUCAAACUGUGGGGGCACUUUCUGCUCUCUGGUGAAAGUGCCGCCAUCUUUUGAGUGUUAC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

This sequence is found in 6 other species

Gorilla gorilla gorilla microRNA 371a (ENSGGOG00000030544.2)
Homo sapiens (human) microRNA hsa-mir-371a precursor
Nomascus leucogenys microRNA 371a (ENSNLEG00000025613.2)
Pan troglodytes ptr-mir-371 (ENSPTRG00000027761.3)
Pongo abelii miRNA (ENSPPYG00000021721.2)
Pongo pygmaeus microRNA ppy-mir-371 precursor

Publications