Sorry, there was a problem loading sequence from server. Please try again and contact us if the problem persists.

Homo sapiens (human) microRNA hsa-mir-1279 precursor URS000075E663_9606

Caution, this is an AI generated summary based on literature. This may have errors, see here for more. Please share your feedback with us.

MIR1279: MIR1279 is a microRNA that presents target sites among paralogous genes of the human tyrosine family and recognizes five target miRNAs, including PTPN12 miRNA [PMC9225252]. In a study, the rs1463335 SNP in the MIR1279 gene was found to be correlated with neuropsychiatric damage [PMC9225252]. Additionally, the rs1463335 SNP of MIR1279 was associated with the development of neuropsychiatric damage in patients [PMC9225252]. The association between neuropsychiatric damage and rs1463335 of MIR1279 was confirmed through multivariate logistic regression analysis [PMC9225252]. The study also revealed an association between TNFSF4 and MIR1279 polymorphisms with irreversible renal damage and the development of neuropsychiatric damage [PMC9225252]. Furthermore, a network map showed that circRNA-0006896 in UA-Exos might upregulate the expression levels of various mRNA molecules by reducing the expression of miR1264, MIR1279, miR570, miR593, miR630, and miR653 [PMC7974330]. In summary, MIR1279 is a microRNA that targets paralogous genes in the human tyrosine family. The rs1463335 SNP in this gene is associated with neuropsychiatric damage. Additionally, this SNP is correlated with an increased risk of developing neuropsychiatric damage. Furthermore, TNFSF4 and MIR1279 polymorphisms are associated with irreversible renal damage and neuropsychiatric damage. Finally, circRNA-0006896 might upregulate mRNA expression by reducing levels of various microRNAs including MIR1279.

Genome locations

Gene Ontology annotations

Sequence

Sequence features are shown above as colored rectangles. Zoom in and click to view details, or Reset

Search for similar sequences
AUAUUCACAAAAAUUCAUAUUGCUUCUUUCUAAUGCCAAGAAAGAAGAGUAUAAGAACUUCC

Taxonomic tree

View annotations in different species by clicking on species names.

Scroll around to explore the entire tree. Click tree nodes to collapse or expand them. Hover over taxon names to display additional information.

Publications